TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01. TABLE 2 Sequences of the primers used for genetic studies of P. heterotricha, and main descriptors of the obtained fragments S, polymorphic sites; h, number of haplotypes; Hd, haplotypes diversity; π, nucleotide diversity; K, average number of nucleotide difference; *, P < 0.05; **, P < 0.01.
DNA fragment Primers sequences S h Hd π K Fragment size Tajimaʼs D Fuʼs Fs References
ITS1/2 ITS1: 5ʼTCCTCCGCTTATTGATATGC 3ʼ 16 12 0.810 0.00390 2.681 701 bp -0.00585 0.383 White et al., 1990
ITS2: 5ʼGGAAGGAGAAGTCGTAACAAGG 3ʼ
trnL-trnF c: 5ʼCGAAATCGGTAGACGCTACG 3ʼ 10 6 0.750 0.00359 2.544 730 bp 1.35790 5.417** Taberlet, 1991
f: 5ʼATTTGAACTGGTGACACGAG 3ʼ
ycf1b ycf1bF: 5ʼACATATG CCAAAGTGATGGAAAA 3ʼ 42 16 0.906 0.01363 8.637 674 bp 8.63671 7.228** Dong et al., 2015
ycf1bR: 5ʼCCTCGCCGAAAATCTGATTGTTGTGAAT 3ʼ
trnL-trnF and ycf1b 52 19 0.919 0.00860 11.634 1,404 bp 0.98381 9.119**